Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

Traveler J - [puzzle] The Parcel
Goto page Previous  1, 2
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Thu Feb 08, 2007 9:15 am    Post subject: Reply with quote

blahblablee wrote:
I think the words on the index card are a anagram...

While I look at the index card are the words glued on?

If so the seperates peices of paper probably represent different parts of the anagram...

Or maybe we have to rearrange it?


Yes, they are pieces of paper glued on. Between 'J' and 'NINETEEN' is a clean cut (i.e. with scissors). There also appear to be rips in between the 'N' and 'C' in 'INCIDENT' and between the 'W' and 'H' in 'WHAT'.
Back to top
View user's profile Send private message Visit poster's website AIM Address  
kellylen
The Order of Denderah


Joined: 21 Nov 2006
Posts: 2823
Location: New Jersey

PostPosted: Thu Feb 08, 2007 9:17 am    Post subject: Reply with quote

hmmmm

do you know anyone with pH paper. someone has to have a pool lol.

something about that solid looks weird. like wet sand... I can't explain it. like its playdough or something...
_________________
-Kelly
Back to top
View user's profile Send private message Send e-mail  
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Thu Feb 08, 2007 9:18 am    Post subject: Reply with quote

In the new video, I believe the morse code is:

Code:

...-- ---.. ---.. ..-. ----. -


which translates to 388F9T

Can someone please double check?
Back to top
View user's profile Send private message Visit poster's website AIM Address  
kellylen
The Order of Denderah


Joined: 21 Nov 2006
Posts: 2823
Location: New Jersey

PostPosted: Thu Feb 08, 2007 9:23 am    Post subject: Reply with quote

which is a tiny url

http://tinyurl.com/388F9T

the text at the tinyurl is a code

Quote:
R0dBR1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUd
BVEdHQ0dHQ0NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUN
HQ0dHR0FHVEdBR0dHR0FHQ0FHVFRHR0dDQ0FBR0FUR
0dDR0dDQ0dDQ0dBR0dHQUNDR0dUR0dHQ0dBQ0dHR0
dHQUdUR0FHR0FUQ0NUVFRUVEFUVENUVENHQUNUQ0F
HR0FUQ0NHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0N
HR0NDR0NDR0FHR0dBQ0NHR1RHR0dDR0FDR0dDR0dBR
1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUdBVEdHQ0dHQ0
NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUNHR0dHQUdUR0
FHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0NHR0NDR0N
DR0FHR0dBQ0NHR1RHR0dDR0FDR0NHR0dBR1RHDQoNC
jEoLTQpIDcoLTQpIDggMSAyIDMgOSgtMSkgNCgrMyk=

_________________
-Kelly
Back to top
View user's profile Send private message Send e-mail  
kellylen
The Order of Denderah


Joined: 21 Nov 2006
Posts: 2823
Location: New Jersey

PostPosted: Thu Feb 08, 2007 9:30 am    Post subject: Reply with quote

ok I did some more research.

base64 which converts to

Quote:
GGAGTGAGGGGAGCAGTTGGGCCAAGAT
GGCGGCCGCCGAGGGACCGGTGGGCGACGCGG
GAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGC
CGCCGAGGGACCGGTGGGCGACGGGGGAGTGAG
GATCCTTTTTATTCTTCGACTCAGGATCCGGGGAG
CAGTTGGGCCAAGATGGCGGCCGCCGAGGGACC
GGTGGGCGACGGCGGAGTGAGGGGAGCAGTTGG
GCCAAGATGGCGGCCGCCGAGGGACCGGTGGGC
GACGGGGAGTGAGGGGAGCAGTTGGGCCAAGATG
GCGGCCGCCGAGGGACCGGTGGGCGACGCGGGAGTG

1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)


which to me is a DNA sequence code. I'm not too sure about the numbers though
_________________
-Kelly
Back to top
View user's profile Send private message Send e-mail  
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Thu Feb 08, 2007 9:39 am    Post subject: Reply with quote

For all intensive purposes, J2 has been destroyed, as instructed.
Back to top
View user's profile Send private message Visit poster's website AIM Address  
theslyestfox
Casual Observer


Joined: 09 Jan 2007
Posts: 44
Location: B.C., Canada

PostPosted: Thu Feb 08, 2007 12:36 pm    Post subject: Reply with quote

kellylen wrote:
ok I did some more research.

base64 which converts to

Quote:
GGAGTGAGGGGAGCAGTTGGGCCAAGAT
GGCGGCCGCCGAGGGACCGGTGGGCGACGCGG
GAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGC
CGCCGAGGGACCGGTGGGCGACGGGGGAGTGAG
GATCCTTTTTATTCTTCGACTCAGGATCCGGGGAG
CAGTTGGGCCAAGATGGCGGCCGCCGAGGGACC
GGTGGGCGACGGCGGAGTGAGGGGAGCAGTTGG
GCCAAGATGGCGGCCGCCGAGGGACCGGTGGGC
GACGGGGAGTGAGGGGAGCAGTTGGGCCAAGATG
GCGGCCGCCGAGGGACCGGTGGGCGACGCGGGAGTG

1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)


which to me is a DNA sequence code. I'm not too sure about the numbers though


so i googled the first three pairs: GGAGTG and came up with this website (among others, but this one had a better explanation of what it's code was about) http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1253837
an excerpt:

Homing endonucleases are enzymes that catalyze DNA sequence specific double-strand breaks and can significantly stimulate homologous recombination at these breaks.<b>These enzymes have great potential for applications such as gene correction in gene therapy or gene alteration in systems biology and metabolic engineering.<b> However, homing endonucleases have a limited natural repertoire of target sequences, which severely hamper their applications. Here we report the development of a highly sensitive selection method for the directed evolution of homing endonucleases that couples enzymatic DNA cleavage with the survival of host cells. Using I-SceI as a model homing endonuclease, we have demonstrated that cells with wild-type I-SceI showed a high cell survival rate of 80–100% in the presence of the original I-SceI recognition site, whereas cells without I-SceI showed a survival rate <0.003%. This system should also be readily applicable for directed evolution of other DNA cleavage enzymes.

which reminded me of how Bree is supposidly one of many genetically altered girls, and a "chosen one" because she was one of the only ones that developed the right characteristics for the ceremony.
but i'm probably reading way to into this.

as for 1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)
i have no idea! we need some of the super clever Op-heads to come over and help us!
_________________
Let's prove science wrong for the rest of our lives!!!


http://www.youtube.com/theslyestfox
Back to top
View user's profile Send private message Visit poster's website MSN Messenger 
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Thu Feb 08, 2007 12:39 pm    Post subject: Reply with quote

I started a separate thread about the video: http://lonelygirl15.com/forum/viewtopic.php?t=6219
Back to top
View user's profile Send private message Visit poster's website AIM Address  
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2
Page 2 of 2

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP