View previous topic :: View next topic |
Author |
Message |
chershaytoute Moderator

Joined: 16 Jan 2007 Posts: 1877 Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!
|
Posted: Sat Mar 24, 2007 6:25 pm Post subject: |
|
|
Bless you, Z! 'zactly what I was just thinking, obviously!
I'll be Goober to your Dork any day...or am I being Dork to your Goober...or...hmmmm...  _________________ Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...
WWggD - let's make the Breeniverse a better place to live...
Thanks to giddeanx for the coolest personal glue stick ever! |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
|
Back to top |
|
 |
chershaytoute Moderator

Joined: 16 Jan 2007 Posts: 1877 Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!
|
Posted: Sat Mar 24, 2007 11:57 pm Post subject: |
|
|
Holy ohmygosh! Now, that would be something... But Traveler J19 referred to Walter has him...so we have a third party reference...? _________________ Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...
WWggD - let's make the Breeniverse a better place to live...
Thanks to giddeanx for the coolest personal glue stick ever! |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Sun Mar 25, 2007 2:09 pm Post subject: |
|
|
Wait.
Holy crap.
OK, "the cure" for XSCID is the X chromosome, if we were talking all poetically or trying to be obtuse. No? Does that make any sense?
I don't even have a good theory about this, it just popped into my head. "Cure for mankind."
If women are the cure... ?
I know we have not been destroying women I'm just thinking out loud (well, writing what I am thinking without thinking about it.)
 _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Sun Mar 25, 2007 2:15 pm Post subject: |
|
|
janesalteredstates wrote: | Wait.
Holy crap.
OK, "the cure" for XSCID is the X chromosome, if we were talking all poetically or trying to be obtuse. No? Does that make any sense?
I don't even have a good theory about this, it just popped into my head. "Cure for mankind."
If women are the cure... ?
I know we have not been destroying women I'm just thinking out loud (well, writing what I am thinking without thinking about it.)
 |
Maybe "J" is THE CURE for "men" being "kind" - or for being men
Edit: Because I made absolutely no sense - synapses were'nt firing yet this morning. _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Last edited by Luminous on Sun Mar 25, 2007 4:22 pm; edited 2 times in total |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
|
Back to top |
|
 |
chershaytoute Moderator

Joined: 16 Jan 2007 Posts: 1877 Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!
|
Posted: Sun Mar 25, 2007 3:59 pm Post subject: |
|
|
Please point me again for re-reading on XSCID?
That sounds like an intriguing point to explore, but...can't explore if I can't remember where, and from the feel of it, I have a migraine approaching... <sigh> _________________ Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...
WWggD - let's make the Breeniverse a better place to live...
Thanks to giddeanx for the coolest personal glue stick ever! |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Sun Mar 25, 2007 4:13 pm Post subject: |
|
|
chershaytoute wrote: | Please point me again for re-reading on XSCID?
That sounds like an intriguing point to explore, but...can't explore if I can't remember where, and from the feel of it, I have a migraine approaching... <sigh> |
No problemo. Sorry about your migraine. I get those too Awful things.
OK, here you go:
This Side of Paradise
deagol's amazingly thorough explanation of how we cam upon XSCID
After that you'll find posts about the disorder(? is it a disorder? Defect?).
Hope that helps. And take some pain killers.
Edit - We need to update the JPedia. Especially the puzzle recaps. *runs away* _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Sun Mar 25, 2007 4:27 pm Post subject: |
|
|
janesalteredstates wrote: |
Edit - We need to update the JPedia. Especially the puzzle recaps. *runs away* |
Hope you're running away to make the needed edits Everyone, feel free to join in - it's a big job keeping this thing up to date!  _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Sun Mar 25, 2007 4:34 pm Post subject: |
|
|
Uhm... yeah, that's what I did.
No, seriously, when I finish this ridiculous Logic homework I'll see what I can do. _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Sun Mar 25, 2007 5:23 pm Post subject: |
|
|
Logic HW? need any help?  |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Sun Mar 25, 2007 5:59 pm Post subject: |
|
|
Are you familiar with Symbolic Logic? (maybe this should be a PM thing ) _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
Back to top |
|
 |
ignatzmouse Enthusiastic Fan

Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Mon Apr 09, 2007 7:54 pm Post subject: |
|
|
A summary of the "Dei Sub Numine Viget" puzzle. This seemed a lot harder at the time
Drop contents:
Quote: | 1 white envelope
1 plastic bag
8 stones (looks like granite pebbles)
2 vials (J-5 and J-6)
1 library catalog card |
On the outside of the envelope it says "From Debrowski." The front of the library card catalog says:
Quote: | (SQ)
QD40
.I536
1985
International Conference on Chemical
Education (8th : 1985 : Tokyo,
Japan) Widening the scope of
Chemistry... 1987.
Union of Pure and Applied Chemistry in
conjunction with the Chemical Society
of Japan"--P. [ii].
Includes bibliographies.
ISBN 0-632-01537-3
1. Chemistry--Study and teaching --
Congress. I. Takeuchi, Yoshito.
1934- II. International Union of
Pure and applied Chemistry. III.
Nihon Kagakkai, IV. Title.
870623 870622 NjP
ZG /ZG A* 87-B28379
86-26421
SQm
E000271 |
On the back it says (all hand written):
Code: | You should know what to do. I suppose it is time to tell you that what you have been destroying is
IKYOIYK
1(+ 8) 3(- 8) 5(+ 16) 3(- 16) 6(+ 16) 2(- 16) 7(+ 24) |
There are eight stones, and the book is the 8th ICCE conference. Walter gave us a series of hints:
Quote: | (The shift +24) provides a multiplicity of clues.
Your comments aren't entirely off base.
It is tough being an Octalgenarian.
You kids may be young now, but you will eventually Convert to be like me, no matter how Plain you start. |
Converting the text IKYOIYK into octal gives:
Code: | 111113131117111131113 |
Reading this as 1=A, 2=B, 3=C, etc. gives:
Code: | AAAAACACAAAGAAAACAAAC |
which codon/shift decrypts as:
Code: | Lysine_Asparagine_Threonine_Lysine_Lysine_Threonine_Asparagine (aminoacid names)
1 3 5 3 6 2 7 (number code)
LPOSEHG
+8 -8 +16 -16 +16 -16 +24 (shifts)
THECURE |
So we are destroying "The Cure". _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
 |
|