Lonelygirl15

Luminous · Posted: Sun Feb 11, 2007 3:44 pm Post subject:

Here is something I did based on the link to the neb site from blablablee above. I input the gene letter sequence that was decoded and got this result.

Then I clicked on 2 cutters (because double edged swords cut twice)under "list" and got this result :

But all of this may be total nonsense, because I have no clue what I'm doing Smile

Here is a new message I just received from Traveler:

We are looking for DNA, not RNA. The correct restriction enzyme, which is what we need to isolate may "Dash before your eyes""If you can count that"

I think this might be a reference to a couple of short sequences that "dash" by really fast in the video "catalyst(find him)".

One is of the briefcase that was sent to McPackage, the other is of someone in a dress shirt pouring something from one test tube into another - possibly the evidence of TravelerJ destroying "J1".

Anyway, I think if we count the dashes in these two sequences, it may point us to the answer we are looking for. Possibly it's morse code? Or maybe just a number we need.

I downloaded the footage so I could isolate the sequences and slow them down, making it easier to count the dashes, I'm not going to be able to get to it until later this evening.

On the subject of "WD, find him".

I'm wondering if that could that be a reference to "W. D. Hardt"? He's a real person though, not a character, so maybe not. But then again, possibly it is his research that we are supposed to be looking into.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

BamHI is a very commonly used restriction enzyme - that might be a good candidate.

Let me know if you find anything in the video's flashes.

Luminous · Posted: Mon Feb 12, 2007 2:09 am Post subject:

Sorry I haven't posted the edited video yet. My editing program crashed, and I've spent the evening troubleshooting. No luck yet. Hopefully I'll have something by tomorrow.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

Brucker · Casual Observer Joined: 13 Oct 2006 Posts: 91

I almost hate to suggest it, but since a restriction anzyme works on both sides of the DNA strand, it might be that the code is on the other side, which would be

CCTCACTCCCCTCGTCAACCCGG
TTCTACCGCCGGCGGCTCCCTGG
CCACCCGCTGCGCCCTCACTCCC
CTCGTCAACCCGGTTCTACCGCC
GGCGGCTCCCTGGCCACCCGCTG
CCCCCTCACTCCTAGGAAAAATAA
GAAGCTGAGTCCTAGGCCCCTCGT
CAACCCGGTTCTACCGCCGGCGG
CTCCCTGGCCACCCGCTGCCGCC
TCACTCCCCTCGTCAACCCGGTTC
TACCGCCGGCGGCTCCCTGGCCA
CCCGCTGCCCCTCACTCCCCTCGT
CAACCCGGTTCTACCGCCGGCGGC
TCCCTGGCCACCCGCTGCGCCCTCAC

Once again, not having a very full understanding of genetic coding principles, if this is the case, I'm not sure if you'd then also process the strand from right to left at your starting point?
_________________
-BRUCKER

Teen1: He's cool.
Teen2: Are you being sarcastic, dude?
Teen1: I don't even know anymore.

(The Simpsons, "Homerpalooza")

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Brucker · Casual Observer Joined: 13 Oct 2006 Posts: 91

Okay, and just for good measure, here's the list offset by one:

Luminous · Posted: Mon Feb 12, 2007 2:00 pm Post subject:

I'm still troubleshooting my editing program, so I don't yet have a clip to post, but I wanted to mention that in "History Lessons (Coded Rings)" it is pointed out that "the gene of interest is a 'Toxic' gene".
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

kellylen · Posted: Mon Feb 12, 2007 2:03 pm Post subject:

if i remember correctly from last semester about DNA, a DNA sequence usually completely ends at a series of As. like A LOT of As.
_________________
-Kelly

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

This is interesting: the following motif "GGAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGCCGCCGAGGGACCGGTGGGCGACG" repeats 4 times within the sequence.

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

I think I'm getting somewhere here... when I cut out the portion of the gene that would be removed by using BamHI (a double-cutting restriction enzyme), nearly all that remains is the 4 repeats of the sequence that I gave above. This repeat comes directly from human nucleoporin DNA. The sequence that would be cut out by BamHI has no significant homology with any other known gene.

Thus, it seems clear that the sequence is composed of two different elements: a repeating sequence from human nucleoporin DNA, and an insert by TravelerJ. I think that it's likely that one of these is significant, and the other is meant to be disregarded.

What do you guys make of this? What, exactly, do you think we're trying to find?

(If someone is willing to bring me up to speed on AIM or somesuch, send me a PM).

Brucker · Casual Observer Joined: 13 Oct 2006 Posts: 91

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Brucker: the reverse complement goes from right-to-left, not left-to-right.

I actually tend to think that the important part isn't the repeating unit, but rather what TravelerJ inserted into the middle (flanked by BamHI cut sites). I'm a bit confused, though, about where to go from here - there's some stuff that I could play around with, but if anyone has any clear ideas what we might be looking for (a word (or tinyurl) coded into the one-letter abbreviated protein sequence? That's about the only thing that comes to my mind), then don't be shy.

Luminous · Posted: Mon Feb 12, 2007 3:11 pm Post subject:

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Luminous: Cool, I'm looking forward to that list.

Just so that everyone knows, a restriction enzyme is a protein that cuts a DNA sequence in a specific location. The terms "5'3'," and "toxic gene" almost certainly refer to the DNA itself. "Double-edged sword" almost certainly refers to the restriction enzyme that is operating upon the DNA.

WD Hardt appears to be a "real-life" German microbiologist/immunologist. His work, while apparently fairly impressive (just judging from a list of his published articles and which journals they went into), doesn't seem immediatly noteworthy. What led you to his name?