| View previous topic :: View next topic |
| Author |
Message |
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
 Posted: Fri Mar 09, 2007 7:53 pm Post subject: |
 |
|
Okay, this is interesting. I don't know if it's intended, or an incredibly uncanny coincidence, but here we go:
So, I took the postmark on the stamp from the new telegram:
egajecrhyrcaacg
I then used this as the passphrase to vigenere-decode the sequence that I found two posts ago (ggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggc)
The first fifteen letters were DNA bases:
Cactcactccatgaa
I translated this, then decoded the resultant five amino acids using the first five numbers that Walter gave on page 17.
I got "XSCID" as a result. Now, that looked a bit like gibberish, but I figured that I'd just google it for the hell of it. Turns out that it's an acronym for a genetic disorder called X-Linked Severe Combined Immunodeficiency.
This disorder is caused by mutations in interleukin receptors. The picture file of Walter's first telegram is titled "interlukin"(sic). The picture file of his second telegram is titled "combined" (the "C" in "XSCID").
What do you guys make of this all?
Last edited by TOSG on Fri Mar 09, 2007 9:11 pm; edited 1 time in total |
|
| Back to top |
|
 |
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Fri Mar 09, 2007 8:13 pm Post subject: |
|
|
| TOSG wrote: |
What do you guys make of this all? |
 Can you run that by me again in English?  I mean the explanation for how you got this far, which clues you used, how you used them and the result you acheived? I'm trying to sort out what we have so far and what is left to do.
Has any of this lead to a next step?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri Mar 09, 2007 8:21 pm Post subject: |
|
|
I've identified the building in the "drop" photo. It's Cleveland Tower at Princeton University. See wikipedia's "Princeton University" entry - the very same photo is included in the article.
EDIT: This Side of Paradise takes place at Princeton University. According to Google Maps, 12 University Place is a real address. I'll update here if I figure out what building is there.
Beautiful campus. All of this searching for pictures of Princeton's buildings makes me sad that I didn't get in there  .
Anyone in the NJ area?
Last edited by TOSG on Fri Mar 09, 2007 8:27 pm; edited 1 time in total |
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri Mar 09, 2007 8:22 pm Post subject: |
|
|
| Luminous wrote: | | TOSG wrote: |
What do you guys make of this all? |
Can you run that by me again in English? I mean the explanation for how you got this far, which clues you used, how you used them and the result you acheived? I'm trying to sort out what we have so far and what is left to do.
Has any of this lead to a next step? |
What part(s) didn't you understand? I wasn't trying to be abstruse. |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Fri Mar 09, 2007 8:32 pm Post subject: |
|
|
| TOSG wrote: | | Luminous wrote: | | TOSG wrote: |
What do you guys make of this all? |
Can you run that by me again in English? I mean the explanation for how you got this far, which clues you used, how you used them and the result you acheived? I'm trying to sort out what we have so far and what is left to do.
Has any of this lead to a next step? |
What part(s) didn't you understand? I wasn't trying to be abstruse. |
For starters, the restriction analysis tool. Which one did you use?
Oh, and good work by the way. I've just been sitting here staring at this stuff hoping it would eventually make sense 
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Fri Mar 09, 2007 8:40 pm Post subject: |
|
|
What do you suppose we do with
"Twelve University Place"
0312-0316
from page 43
and "Do you mind if I drop the Don?"
from page 245
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri Mar 09, 2007 8:41 pm Post subject: |
|
|
| Luminous wrote: | | TOSG wrote: | | Luminous wrote: | | TOSG wrote: |
What do you guys make of this all? |
Can you run that by me again in English? I mean the explanation for how you got this far, which clues you used, how you used them and the result you acheived? I'm trying to sort out what we have so far and what is left to do.
Has any of this lead to a next step? |
What part(s) didn't you understand? I wasn't trying to be abstruse. |
For starters, the restriction analysis tool. Which one did you use?
Oh, and good work by the way. I've just been sitting here staring at this stuff hoping it would eventually make sense |
I used NEBCutter v2.0 (http://tools.neb.com/NEBcutter2/index.php). I think I gave you a link to it in a PM a little while back. It shows you which restriction enzymes will cut a given sequence of DNA, and where they will cut. Here, I used this to see where NotI cut the DNA sequence that I obtained. |
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri Mar 09, 2007 8:46 pm Post subject: |
|
|
| Luminous wrote: | What do you suppose we do with
"Twelve University Place"
0312-0316
from page 43
and "Do you mind if I drop the Don?"
from page 245 |
Good question. I was thinking about that too. In terms of page 43, "12 University Place" appears to be a real address of a building at Princeton. In the novel, the building is a dorm, although I do not know if it still exists or is used for that purpose. Perhaps it could be the location of Cleveland Tower, the building in the drop photo. If it's a drop location, 0312-0316 could refer to room numbers in/near which the drop is located.
For the quote on page 245, maybe it just is supposed to indicate that there has been/will be a drop. But maybe "the Don" also refers to something too.
I recognize that my previous posts were a little "non-linear," but so was the information that I found. I don't know if I found a complete solution, but there's lots of stuff to think about. I might post a recap/summary, but I worry that it would be redundant. |
|
| Back to top |
|
|
trainer101
Moderator Manager
Joined: 20 Sep 2006
Posts: 2671
Location: Wasting away again ILLUMINATIVILLE...
|
| Posted: Fri Mar 09, 2007 9:01 pm Post subject: |
|
|
As I read through this, it certainly "sounds" like a drop at Princeton. McPackage received his first parcel with a return address in SoCal. This one with a return address in NJ. Are we in the middle of a cross country collaboration or does Traveler J really travel?
_________________
It's STILL all connected... |
|
| Back to top |
|
|
McPackage
Casual Observer
Joined: 22 Jan 2007
Posts: 76
Location: California
|
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri Mar 09, 2007 9:06 pm Post subject: |
|
|
Day late, dollar short.
Kidding. |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Fri Mar 09, 2007 9:10 pm Post subject: |
|
|
| TOSG wrote: | | Luminous wrote: | What do you suppose we do with
"Twelve University Place"
0312-0316
from page 43
and "Do you mind if I drop the Don?"
from page 245 |
Good question. I was thinking about that too. In terms of page 43, "12 University Place" appears to be a real address of a building at Princeton. In the novel, the building is a dorm, although I do not know if it still exists or is used for that purpose. Perhaps it could be the location of Cleveland Tower, the building in the drop photo. If it's a drop location, 0312-0316 could refer to room numbers in/near which the drop is located.
For the quote on page 245, maybe it just is supposed to indicate that there has been/will be a drop. But maybe "the Don" also refers to something too. |
So you think there might be a drop at Princeton? Or that there is going to be? Anyone close to Princeton who wants to go check it out?
| TOSG wrote: | | I recognize that my previous posts were a little "non-linear," but so was the information that I found. I don't know if I found a complete solution, but there's lots of stuff to think about. I might post a recap/summary, but I worry that it would be redundant. |
Actually, they are pretty informative. There are just so many things I don't know, like what is a restriction analysis tool How do I use it? How do I read it? It's just homework I have to do.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri Mar 09, 2007 9:15 pm Post subject: |
|
|
| Luminous wrote: |
So you think there might be a drop at Princeton? Or that there is going to be? Anyone close to Princeton who wants to go check it out? |
It seems like there's a lot of evidence for that being the case. I'm not on the east coast, though, nor do I have any good friends at Princeton, so I can't be of much help here.
| Luminous wrote: |
Actually, they are pretty informative. There are just so many things I don't know, like what is a restriction analysis tool How do I use it? How do I read it? It's just homework I have to do. |
Yeah, make up a sequence (or use one of the ones from an old puzzle) and play around with it on the link that I gave you for NEBCutter. That's the best way to learn. I think I explained some of these techniques more thoroughly in posts for previous puzzles, when this stuff was being done for the first time. Since this is the third puzzle that I used NEBCutter to help solve, I just treated it as if it were "routine." If you or anyone else has questions regarding the mechanics of what I've been doing, I'd be happy to answer them here or by PM. |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Fri Mar 09, 2007 9:22 pm Post subject: |
|
|
| TOSG wrote: |
| Luminous wrote: |
Actually, they are pretty informative. There are just so many things I don't know, like what is a restriction analysis tool How do I use it? How do I read it? It's just homework I have to do. |
Yeah, make up a sequence (or use one of the ones from an old puzzle) and play around with it on the link that I gave you for NEBCutter. That's the best way to learn. I think I explained some of these techniques more thoroughly in posts for previous puzzles, when this stuff was being done for the first time. Since this is the third puzzle that I used NEBCutter to help solve, I just treated it as if it were "routine." If you or anyone else has questions regarding the mechanics of what I've been doing, I'd be happy to answer them here or by PM. |
Maybe we could write up some instructions post them in the toolkit on the LGpedia page?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
trainer101
Moderator Manager
Joined: 20 Sep 2006
Posts: 2671
Location: Wasting away again ILLUMINATIVILLE...
|
| Posted: Fri Mar 09, 2007 9:25 pm Post subject: |
|
|
| Luminous wrote: | | Maybe we could write up some instructions post them in the toolkit on the LGpedia page? |
That's a real good idea. I was just looking through LGpedia, you've done a great job!
_________________
It's STILL all connected... |
|
| Back to top |
|
|
|
FAQ
Search
Memberlist
Usergroups
Register
Profile
Log in to check your private messages
Log in
