Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

[Puzzle] Facility J - "This Side of Paradise"
Goto page Previous  1, 2, 3, 4, 5, 6  Next
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Fri Mar 09, 2007 9:28 pm    Post subject: Reply with quote

trainer101 wrote:
Luminous wrote:
Maybe we could write up some instructions post them in the toolkit on the LGpedia page?

That's a real good idea. I was just looking through LGpedia, you've done a great job!


Yeah, it's not a bad idea. Technical writing is hardly one of my passions, but I do recognize that it would be helpful for a lot of people. I might try my hand at it later on. I do think that it's most instructive just to play around with the various tools, though. Take an old puzzle and try to solve it, using my solution breakdowns as guidelines, as much or as little as you fancy.
Back to top
View user's profile Send private message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Fri Mar 09, 2007 9:44 pm    Post subject: Reply with quote

Thanks Trainer You made my day Smile

So I know some people near Princeton. Should I start making phone calls?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Fri Mar 09, 2007 10:41 pm    Post subject: Reply with quote

I tried to follow along with TOSG, but he was always one step ahead of me. Must have been because I did try to document everything linearly. Razz That 'p' that was supposed to be an 'r' gets fixed when using the "right" stop.

Sorry if this is mostly redundant, and for abusing the wide formatting, but it was the clearest way I could think to show the number decoding. Hope it helps!

NotI:gcggccgc

Quote:
He was ashamed of the fact that very simple and honest people usually distrusted him; that he had...

Vigenere decrypt:
Code:
text:hewasashamedofthefactthatverysimpleandhonestpeopleusuallydistrustedhimthatheh
key1:hydymyzhamekizrbydywrahaatllwmignsehnkovllzrwcvwflsqbhfsfkgzalbmncxbgknfutfyf
msg1:agtcgctaaaatggcggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggcggccgcgacgc

NEBcutter (select 2 cutters link after first result):
Code:
seq1:agtcgctaaaatggcggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggcggccgcgacgc
                  --^-----                                           --^-----
Cuts:              NotI                                               NotI
seq2:               ggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggc


Protein 1-letter code translation and full names (notice the stop is taa=Ochre):
Code:
pr.trans:G R Ochre(stop) S A S Y I S S L V L V S C G
pr.names:Glycine_Arginine_Ochre_Serine_Alanine_Serine_Tyrosine_Isoleucine_Serine_Serine_Leucine_Valine_Leucine_Valine_Serine_Cysteine_Glycine
               ^   ^         ^   ^          ^   ^        ^          ^       ^    ^       ^      ^       ^          ^  ^      ^        ^
letters#:      7   3         4   2          6   2        4          6       3    1       2      1       2          5  1      1        1
egreneoursevenscg


shifts:-11 1 0 0 -9 1 0 0 0 0 0 0 0 0 0 1 1
For this part I also like to use the Vigenere tool, deriving a key from the shifts by making 0=a, 1=b, -1=25=z, etc.

Vigenere encrypt:
Code:
ltr1:egreneoursevenscg
key2:pbaarbaaaaaaaaabb
msg2:threefoursevensdh

http://tinyurl.com/347sdh

From the stamp, Vigenere decrypt:
Code:
seq2:ggccgctaatctgcg
key3:egajecrhyrcaacg
msg3:cactcactccatgaa

Again, protein 1-letter code translation and full names:
Code:
pr.trans:H S L H E
pr.names:Histidine_Serine_Leucine_Histidine_Glutamate
               ^     ^       ^     ^             ^
letters#:      7     3       4     2             6
ircim

And finally the same shifts, Vigenere encrypt:
Code:
ltr2:ircim
key2:pbaar
msg4:xscid

http://en.wikipedia.org/wiki/XSCID

Quote:
It is also known as the "bubble boy" disease because its victims are extremely vulnerable to infectious diseases.

Kind of brings me back to the telegram, "...they wanted a way to protect a chosen few."


Tools used (also linked on each step):
http://rumkin.com/tools/cipher/vigenere.php
http://tools.neb.com/NEBcutter2/index.php
http://www.expasy.ch/tools/dna.html
http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table


Last edited by deagol on Fri Mar 09, 2007 10:53 pm; edited 2 times in total
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Fri Mar 09, 2007 10:51 pm    Post subject: Reply with quote

Nice work documenting everything, deagol. If people find that sort of formal approach to be easier to follow, let me know - I can start documenting my solutions like that as well.

And good work getting the "r" in "three"! I didn't think to actually use the name of the stop codon - that's pretty obscure, so it's awesome that you figured it out.

And Luminous: Sure, if you think they'd be willing/interested. There's a good possibility that it could be a wild goose chase, but I'm not sure how best to narrow in on what we're exactly looking for.

It might not be a bad idea for someone to send Walter a message and see if he can confirm that there's been a drop, so that nobody wastes their time on the ground.

EDIT: Sorry, deagol, I bollocksed your username! It's corrected now, though.


Last edited by TOSG on Fri Mar 09, 2007 11:31 pm; edited 1 time in total
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Fri Mar 09, 2007 11:14 pm    Post subject: Reply with quote

Well I don't think every step needs to be documented like that from now on once people learn how it's done. Indeed you did a great job explaining it before and although I can catch on pretty quickly, I know how tough these things are for others. I thought showing it step by step with all the details and linking the corresponding tools might also help with the suggestion of a tutorial here.

I think this is definitely a drop in Princeton, and I like 0312-0316 beeing room numbers (or maybe mailbox numbers) at 12 University Place in Princeton. That's as narrowed-down a location as you can get.

And this is interesting, also from that wiki page on XSCID:

Quote:
Trial treatments of SCID have been gene therapy's only success; since 1999, gene therapy has restored the immune systems of at least 17 children with two forms (ADA-SCID and X-SCID) of the disorder.


Might there be 2 more kids? You know, the J19...


Last edited by deagol on Fri Mar 09, 2007 11:24 pm; edited 1 time in total
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
trainer101
Moderator Manager


Joined: 20 Sep 2006
Posts: 2671
Location: Wasting away again ILLUMINATIVILLE...

PostPosted: Fri Mar 09, 2007 11:21 pm    Post subject: Reply with quote

Amazing work again Deagol and TOSG! You are in a groove - the last puzzle took days.

I agree, we should get some confirmation from Walter or TravelerJ before we send anyone on a wild goose chase.
_________________
It's STILL all connected...
Back to top
View user's profile Send private message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Fri Mar 09, 2007 11:25 pm    Post subject: Reply with quote

TOSG wrote:
It might not be a bad idea for someone to send Walter a message and see if he can confirm that there's been a drop, so that nobody wastes their time on the ground.


Excellent idea (duh) I just dropped Walter a line to let him know the package was received and has been decoded and we're wondering . . .

I've sent out a few inquiries on possible drop retrievers. No takers yet. If we get confirmation back from Walter, maybe ladron121 from the OpAphid crew would be willing to lend us one of his drop retrievers, if he has anyone near Princeton?

Oh, and Deagol. WOW! What a breakdown. Thanks.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
shadower
Suspiciously Absent


Joined: 25 Nov 2006
Posts: 20
Location: United States

PostPosted: Fri Mar 09, 2007 11:37 pm    Post subject: Reply with quote

wow I just stumbled upon this and I have to say I love this!
I'm bio nerd and genetics/dna is my favorite part!

Also if there was a drop, i would have loved to help because I'm on a few hours drive away, (here comes the big but!!) I'm driving back to school this weekend and it's in the completely opposite direction.

So quick question (because i'm lazy, it's late and so on) have all the problems, so far, been dna-ish based? or have they been more like the opaphid style, where knowledge of specific computer coding is needed?
_________________
"The true work of art is but a shadow of the divine perfection." ~Buonarroti Michelangelo

I'm just an observer, loving the game...
Back to top
View user's profile Send private message
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Fri Mar 09, 2007 11:39 pm    Post subject: Reply with quote

shadower wrote:
wow I just stumbled upon this and I have to say I love this!
I'm bio nerd and genetics/dna is my favorite part!

Also if there was a drop, i would have loved to help because I'm on a few hours drive away, (here comes the big but!!) I'm driving back to school this weekend and it's in the completely opposite direction.

So quick question (because i'm lazy, it's late and so on) have all the problems, so far, been dna-ish based? or have they been more like the opaphid style, where knowledge of specific computer coding is needed?


Yep, the ARG and its puzzles have a definite scientific theme. Check out some of the previous puzzle threads and also Luminous' article on FacilityJ in the LGPedia.
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Fri Mar 09, 2007 11:41 pm    Post subject: Reply with quote

TOSG wrote:
EDIT: Sorry, deagol, I bollocksed your username! It's corrected now, though.

Haha... I thought you had it right in the first place, as I've pretty much been a "Lurker" in this side of the forum. Very Happy
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
Ziola
The Order of Denderah


Joined: 17 Oct 2006
Posts: 5774

PostPosted: Sat Mar 10, 2007 9:19 am    Post subject: Reply with quote

Well, I'm at least on the East Coast (New England) but Princeton is a tad to far away for me. I do have people I can call down in that area though, if the need arises. Let me know if you all get confirmation from Walter and I'll get on the horn.
Back to top
View user's profile Send private message
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sat Mar 10, 2007 2:57 pm    Post subject: Reply with quote

Wow, I always get here too late.
But let me know when Walter gets to Fiji Laughing Cool
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
ladron121
Devoted Fan


Joined: 24 Oct 2006
Posts: 855

PostPosted: Sun Mar 11, 2007 1:15 pm    Post subject: Reply with quote

My ears were burning, knew my name was mentioned Smile

Sadly, I'm in Sacramento, CA. Princeton is too much of a drive Wink

However, hit me up if there's anything going on in Nor Cal
Back to top
View user's profile Send private message
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Sun Mar 11, 2007 8:24 pm    Post subject: Reply with quote

Any word from Walter on whether the suspected drop has indeed occurred?
Back to top
View user's profile Send private message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Sun Mar 11, 2007 8:37 pm    Post subject: Reply with quote

Nothing yet. He's remaining suspiciously silent.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2, 3, 4, 5, 6  Next
Page 3 of 6

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP