| View previous topic :: View next topic   | 
	
	
	
		| Author | 
		Message | 
	
	
		ignatzmouse Enthusiastic Fan
  
  Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
  | 
		
			
				 Posted: Sun Apr 01, 2007 12:57 pm    Post subject: FacilityJ [Solution] - "Catalyst (You Rang?)" | 
				     | 
			 
			
				
  | 
			 
			
				Here is my summary of the "You Rang?" puzzle.  It makes a lot more sense when you cut out all the dead ends we went down  
 
 
The original video: http://www.youtube.com/watch?v=86cKFW2mV4E
 
 
Contains Morse Code:
 
 	  | Quote: | 	 		  | -.-- -. .--. ---.. ...- -.-. | 	  
 
which decodes as:
 
 
The URL http://tinyurl.com/ynp8vc resolves to http://sfbay.craigslist.org/sfc/mis/301063692.html which says:
 
 	  | Quote: | 	 		  Walter says "hi."
 
 
Walter was as pleasant to deal with as he always is. He told me that we have been helping him to destroy “the cure.” He wouldn’t explain any more than that. I don’t even know what that means. Sure he’s had some issues in the past, but he can’t really be that crazy can he? I don’t know if I should even keep helping him or not. I do know that if they were after him, then they’re probably after me now that I have more vials of the stuff. I guess I should send it out to some of you who may be smarter than I am and can figure it all out. You can decide what to do with the vials. Just send the full address to my YT account like before. Include the word that you get from the code in this message, so that I know that you are clever enough to know what to do with the vials.
 
 
QVRUQ0NUQVRDQVRUQVRBQVRDQVRBVEFBQVRUR0FUQVRDQVRBDQo2KC1hKSA2KC1iKSA2KC1hKSAx
 
MigtYykgNigtYSkgMTIoLWMpIDYoLWEpIDEyKC0wKSA2KC1hKSA2KC1kKSA2KC1hKSAxMigtYykN
 
Cg0KYTogdGhlIHN0YXRlIHRoYXQgSZJtIGluDQpiOiB0cmF2ZWxlcnMgaGF2ZSBubyBvbmUgdG8g
 
Z28gaG9tZSB0bw0KYzogSZJ2ZSBoYWQgYSByb3VnaCB5ZWFyLCBidXQgSSBzdGlsbCBzbWlsZQ0K
 
ZDogdGhlcmUgbWF5IGJlIG1vcmUgdHJvdWJsZSBpbiBteSBmdXR1cmUgdGhhbiB0cmliYmxlcw0K
 
aHR0cDovL3d3dy5jcmVlYm9iYnkuY29tL3NvbmdzZm9yYXNtYWxsc3RlcmVvLmh0bWwNCg== | 	  
 
The last paragraph Base64 decodes to:
 
 	  | Code: | 	 		  ATTCCTATCATTATAATCATATAAATTGATATCATA
 
6(-a) 6(-b) 6(-a) 12(-c) 6(-a) 12(-c) 6(-a) 12(-0) 6(-a) 6(-d) 6(-a) 12(-c)
 
 
a: the state that I’m in
 
b: travelers have no one to go home to
 
c: I’ve had a rough year, but I still smile
 
d: there may be more trouble in my future than tribbles
 
http://www.creebobby.com/songsforasmallstereo.html | 	  
 
The DNA codons are:
 
 	  | Code: | 	 		  Isoleucine
 
Proline
 
Isoleucine
 
Isoleucine
 
Isoleucine
 
Isoleucine
 
Isoleucine
 
Ochre
 
Isoleucine
 
AsparticAcid
 
Isoleucine
 
Isoleucine | 	  
 
The URL contains a playlist:
 
 	  | Quote: | 	 		  1. For Karina
 
2. You're In Love Again
 
3. My Sweet Skyline
 
4. How's It Goin', Wells?
 
5. The Ship Is Real
 
6. Sweet Like Worms
 
7. 6,000,000 Dead Punks Can't Be Wrong.
 
8. The Little Homie In My Tummy
 
9. White Amplifier 1956
 
10. He Kept Painting
 
11. Same As Always
 
12. If You Loved Anyone (Mary 2004) | 	  
 
plus a lyric sheet which is enough to answer the questions:
 
 	  | Quote: | 	 		  a: state (#6 Sweet Like Worms)
 
b: go home (#1 For Karina)
 
c: rough year smile (#4 How’s It Going, Wells?)
 
d: tribbles (#5 The Ship Is Real) | 	  
 
Substituting a b c d for 6 1 4 5 in the shifts:
 
 	  | Code: | 	 		  | 6(-6) 6(-1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4) | 	  
 
This fails to apply to the DNA codons, as 12 is out-of-range.  But we got a hint from TJ19:
 
 	  | Quote: | 	 		  | http://www.looperama.com/ | 	  
 
and "looping" the DNA codons:
 
 	  | Code: | 	 		  Isoleucine
 
ProlineProlineProline
 
IsoleucineIsoleucineIsoleucine
 
IsoleucineIsoleucineIsoleucine
 
IsoleucineIsoleucineIsoleucine
 
IsoleucineIsoleucineIsoleucine
 
IsoleucineIsoleucineIsoleucine
 
OchreOchreOchre
 
IsoleucineIsoleucineIsoleucine
 
AsparticAcidAsparticAcidAsparticAcid
 
IsoleucineIsoleucineIsoleucine
 
IsoleucineIsoleucineIsoleucine | 	  
 
then applying the shifts gives:
 
 
A further hint from TJ19 said that the second shift should be 6(+1) rather than 6(-1) so now we have:
 
 
Swapping the 12(C) for the matching 12(-0) gives:
 
 	  | Code: | 	 		  6(-6) 6(-1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(C) 6(-6) 6(-5) 6(-6) 12(-4)
 
OOOOOOOOOOOO | 	  
 
and reading off the second component of each shift gives:
 
 
which is hex/ascii for:
 
 
which is the solution. _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		trainer101 Moderator Manager
  
  Joined: 20 Sep 2006 Posts: 2671 Location: Wasting away again ILLUMINATIVILLE...
  | 
		
			
				 Posted: Sun Apr 01, 2007 1:49 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				I split this off into a discussion so it gets the attention it deserves.    _________________ It's STILL all connected... | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		TOSG Devoted Fan
  
  Joined: 14 Sep 2006 Posts: 651
 
  | 
		
			
				 Posted: Sun Apr 01, 2007 2:02 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				Excellent work on a tough puzzle!
 
 
I knew that it wouldn't be long before you cracked one of these, i-mouse. | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		janesalteredstates Devoted Fan
  
  Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
  | 
		 | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		trainer101 Moderator Manager
  
  Joined: 20 Sep 2006 Posts: 2671 Location: Wasting away again ILLUMINATIVILLE...
  | 
		
			
				 Posted: Sun Apr 01, 2007 3:31 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				We are waiting on word from Traveler J about the next delivery. He asked for an address and Ziola volunteered to receive the next package. _________________ It's STILL all connected... | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		Ziola The Order of Denderah
  
  Joined: 17 Oct 2006 Posts: 5774
 
  | 
		
			
				 Posted: Sun Apr 01, 2007 4:29 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				Thank you thank you thank you for the breakdown!!  That makes it so much easier for my little brain to comprehend    
 
 
And as of yet, I have not received confirmation from TJ that he will be sending me the package... | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		ignatzmouse Enthusiastic Fan
  
  Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
  | 
		
			
				 Posted: Sun Apr 01, 2007 4:49 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				 	  | TOSG wrote: | 	 		  Excellent work on a tough puzzle!
 
 
I knew that it wouldn't be long before you cracked one of these, i-mouse. | 	  
 
Thank you.  Of course, Deagol did most of the productive work on this one, I concentrated more on dead ends, and grabbing the glory right at the last minute   _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		Luminous Thor's Hammer
  
  Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
  | 
		
			
				 Posted: Sun Apr 01, 2007 6:01 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				Nice summary mouse, thanks. I'll link this to the Jpedia. _________________ You made a wise choice, Bree.
 
There's no place like home.
 
Click to watch: The Ice Princess | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		janesalteredstates Devoted Fan
  
  Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
  | 
		
			
				 Posted: Sun Apr 01, 2007 7:40 pm    Post subject:  | 
				     | 
			 
			
				
  | 
			 
			
				 	  | trainer101 wrote: | 	 		  | We are waiting on word from Traveler J about the next delivery. He asked for an address and Ziola volunteered to receive the next package. | 	  
 
 
Thanks Z!   _________________ “It takes a thousand voices to tell a single story. ”
 
http://youtube.com/profile?user=jenlight | 
			 
		  | 
	
	
		| Back to top | 
		 | 
	
	
		  | 
	
	
		 |